Quickstart

Bamnostic is meant to be a reduced drop-in replacement for pysam. As such it has much the same API as pysam with regard to BAM-related operations.

Note

the pileup() method is not supported at this time.

Importing bamnostic

import bamnostic as bs

Loading your BAM file

Bamnostic comes with an example BAM (and respective BAI) file just to play around with the output. Note, however, that the example BAM file does not contain many reference contigs. Therefore, random access is limited. This example file is made available through bamnostic.example_bam, which is a just a string path to the BAM file within the package.

>>> bam = bs.AlignmentFile(bs.example_bam, 'rb')

Get the header

Note: this will print out the SAM header. If the SAM header is not in the BAM file, it will print out the dictionary representation of the BAM header. It is a dictionary of refID keys with contig names and length tuple values.

>>> bam.header
{0: ('chr1', 1575), 1: ('chr2', 1584)}

Data validation through head()

>>>bam.head(n=2)
[EAS56_57:6:190:289:82  69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192,
 EAS56_57:6:190:289:82  137 chr1    100 73  35M =   100 0   AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2; MF:C:64 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0]

Getting the next read

>>> print(next(bam))
EAS56_57:6:190:289:82       69      chr1    100     0       *       =       100     0       CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA     <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<;     MF:C:192

Exploring a read

# Using a more complex read
>>> for complex_read in bam:
...     if complex_read.read_name == 'EAS218_4:1:48:9:409':
...         print(complex_read)
...         break
EAS218_4:1:48:9:409 99      chr1    271     75      18M5I12M        =       464     228     GTTTAGTGCCTTTGTTCACATAGACCCCCTTGCAA     <<<<<<<<<<<<<:<<<<<<<<<<<<<<<<<<<<<     MF:C:130        Aq:C:75 NM:C:0  UQ:C:0  H0:C:0  H1:C:0

There are, essentially, 3 contexts of a given read:

  1. (raw) The raw read

  2. (aligned) The sequence that aligns (including insertions but not clipping)

  3. (reference) The sequence that aligns to the reference only (excluding clipping and insertions)

Let’s explore an example of those different contexts.

Read Name

>>> print(complex_read.read_name)
EAS218_4:1:48:9:409

0-based Start Position (raw, aligned, reference)

If you look at the next code example, you will see that the start position is listed as 270, while when we printed out the read earlier, it showed as 271. This is because special care was taken to ensure all printed versions of the read followed traditional SAM format, which is 1-based. This means that the print() output of a read is always guaranteed to be a valid SAM entry.

However, all direct access attributes will be treated as 0-based, so as to fit in line with common Python conventions.

>>> print(complex_read.pos, complex_read.query_alignment_start, complex_read.reference_start)
270 270 270

CIGAR & QUAL Strings

>>> print(complex_read.cigarstring)
18M5I12M

# ASCII-encoded and offset quality scores
>>> print(complex_read.qual)
<<<<<<<<<<<<<:<<<<<<<<<<<<<<<<<<<<<

# Decoded and raw
>>> print(complex_read.query_qualities)
array('B', [27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 25, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27])

Sequence Length (raw, aligned, reference)

Since the CIGAR string contains an insertion of 5 bases, the read’s reference length should be 5 bases shorter than the query.

>>> print(complex_read.query_length, complex_read.query_alignment_length, complex_read.reference_length)
35 35 30

Nucleotide Sequence

# nucleotide sequence (raw)
>>> print(complex_read.query_sequence)
GTTTAGTGCCTTTGTTCACATAGACCCCCTTGCAA

# nucleotide sequence (aligned)
>>> print(first_read.query_alignment_sequence)
GTTTAGTGCCTTTGTTCACATAGACCCCCTTGCAA

# the reference sequence cannot be generated because the read does not have
# an MD tag associated with the CIGAR string

Read Flag and Decoded Flag

>>> print(first_read.flag)
69

# decoded FLAG
>>> bs.utils.flag_decode(first_read.flag)
[(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]

Serial Access

>>> bam = bs.AlignmentFile(bs.example_bam, 'rb')
>>> for i, read in enumerate(bam):
...    if i >= 3:
...        break
...    print(read)

EAS56_57:6:190:289:82       137     chr1    100     73      35M     =       100     0       AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC     <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2;     MF:C:64 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0
EAS51_64:3:190:727:308      99      chr1    103     99      35M     =       263     195     GGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGG     <<<<<<<<<<<<<<<<<<<<<<<<<<<::<<<844     MF:C:18 Aq:C:73 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
EAS112_34:7:141:80:875      99      chr1    110     99      35M     =       265     190     AGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAA     <<<<<<<<<<<<<<<<<<<<<<:<<8;<<8+7;-7     MF:C:18 Aq:C:69 NM:C:0  UQ:C:0  H0:C:1  H1:C:0

Random Access

>>> bam = bs.AlignmentFile(bs.example_bam, 'rb')
>>> for i, read in enumerate(bam.fetch('chr2', 1, 100)):
...    if i >= 3:
...        break
...    print(read)

B7_591:8:4:841:340  73      chr2    1       99      36M     *       0       0       TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA    <<<<<<<<;<<<<<<<<;<<<<<;<;:<<<<<<<;;    MF:C:18 Aq:C:77 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
EAS54_67:4:142:943:582      73      chr2    1       99      35M     *       0       0       TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA     <<<<<<;<<<<<<:<<;<<<<;<<<;<<<:;<<<5     MF:C:18 Aq:C:41 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
EAS54_67:6:43:859:229       153     chr2    1       66      35M     *       0       0       TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA     +37<=<.;<<7.;77<5<<0<<<;<<<27<<<<<<     MF:C:32 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0